Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537002
Length 772 bp
Fasta Format > rwhei1f03
agttttaggaaactcaaaagtggaatcactccacttcaaaaaaaatgcac ttcaagattacggcccccaaaatcactaagagagcaccactcctcttgtg ccagtgaaaacagaactttagactgatatggtacaatcattaatcatttg actgatgcttttacagccttctctgcagcatcatcaagatcctctgcagt gatcaatgtcattccactctccttaagaatccttttcccttggtctacat tggtgccttctagccgaacaacaacagggaccttaagatcaacctgttta gctgcattcactattccacttgctatcacgtcacatttcatgatacctcc aaaaatgttcactagaattgccttcactctatcgtctgaagtcaatatct taaatgcttccacaacctgtccctcggatgcactaccaccaacatcaaga aaattggcaggtgtaccaccatgcagcttaatgatgtccatcgtagccat tgccaatcctgcaccattcaccatgcaaccaatctctccatcaagcccga tgtagttcaaatctgctttagcagcagccacctctctggggtcctcctgt gttgtatcacgcagtgcaaatatttctttctgcctaaacgcagcattatc atcgaagttcaactttgcatcagcagcaactagctttttatcagctgtct cagcaagaggatttatctccagcattgtgcagtcggtcttgcagaaaagt tcatatagcttcttaatctgnt
Download
page-top