Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ537001
Length 726 bp
Fasta Format > rwhei1e24
agcggggtaatcggtaccaagcataaatacacacatcacagctgagttca tatacataatacatgcatctgcagaaacggaaaacaaaatcctgggttca actatacccttcttttaccttctcattagaagtaaacagtgtagtttttg aagagctgaaactggctactcagctttccaagatgacaatggaggggtct cagactccttccaagtactagccattggagggtacctgtcaccctgaaca tcacctgcagccgcgtaagattcgagttcagccatttcctctggtgtgag cttcacagctaatgctcccacattttggttgaaattatcgatttttgttg tgccaggtatggggcagacatcgctaccctggtggtgaacccaagccaag gcaagttgtgatggtgtgcatccttttcttgtcgccatcgcgtcaacacg ctcaaatatctgggcattcttctcgagactctctggttgaaatctaggta aattcttgcggaagtcctggtctgatagtgagtcaaccaattttgctcct ttagagaagaatcctctaccaagtgggctgtaagcaacaattccaattcc aagttctctgcaagttggaattatgtcttcttcgacatctctagaccaca gtgaccattccatctgaactgcagtgataggatgaacagcatgagccctc ctgattgttgatgcggatgcttcaga
Download
page-top