Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536996
Length 525 bp
Fasta Format > rwhei1e19
aagtctcatactactaatagcaaaccaccggcagntgcaacaaataccat gaaaagcatagctcatgtacacctaaactacgctgcagaancctctcaga ctgttgccaacacganaatgccttcctgctgngntgccnatgcncttcat tccagctcactactactgtanctcgnngatgcaccacaggtnctcgggga cctcctctcnnantgnggggttctgcagcgcgagctcctcggagacgtnc nccagcccctgnatcagcctcaccacctccgccgtgtcgtccangtagta cttggccttgctcggnttgcggccgacggtgcangngaanacctccgncg tggacgctaacgagtcggcgcaggaggagctggtgatgaactggaacatg tcctcgtnggagcggtcgtccccgatgcagagcacgaagtccgggcacat gcccctctcctggagcgccgccagcatgcgccgcgccaccaggcccttgc tcacgccctgcggcttagcttcgac
Download
page-top