Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536991
Length 503 bp
Fasta Format > rwhei1e11
tatggtgaatgcaccttcctccgatacatatgagaagtaaacaaaaatgt actagacacattacaaaactcttcaagggtctcactcttcggatcgcata aaaagtcgtgagatctacactataggtccaaacaccggaagaatttgtac tttaattttggcgagctctggagcaaagctaagccccgtttctagaacca aagctatcttcccgcgctcttctgcttgcctttcttcgggtctttcttgg aactagtcgacgcactggcctcttcctccgccttttgttcagcctccagc acggccagctcatcaagtatgggtttcagttccttgaatcgagtttcggc aagatcaaaaccatccttgcggagctcctttccggtgtgttgagtgtgct cgtaggcagccatttgccagtacatatttgttctcttgtagaaatctctc agtgactctcctggcgttggtgtcctttgagaatcagaaagaccgaggat gac
Download
page-top