Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536985
Length 755 bp
Fasta Format > rwhei1e01
agagtacagcctcgtgatgaggaaagttgaaccccggcagccatggactg ctactcgtgacgaactcgaccaccctaatgccatggggttggactgagga cagacacacgtgcgaccttgacggtggagggttgcggcggtggcggcatg ctggaacgaggaggcgacgcactagaaggaggcagttctgccacacggtt cggccttgtcccagcttcatcttgcctaacttcacaacaaatcacttgta ggcatgaacagaaacacctataggactgcacgaacccacacaaaaataag ttagttgtaaactcgtgaggcagccagaatcaactcggatgcaatgtttc aagaagcctggctcccacaatttttctcctgtacttgctctctcttcacc cgtcccttttattctctttcttatttatcaaatccaaacgtattagcaac aacaacttggctccaataagaaaaatgcagaggatgggggcagcagcgtg caactggcagtatgctcaccattttttttgtagggatgcatgtacatgtt gcagccgaagaaataccaaggagcttttctgaaaacaaactatgttgaac tgccacaaatctattttggctagcaaaacttgaaccgaaaaagcctacaa aggtgtacacatatatagcaaatcctatgaaacacatttgattttttttg cttttgataagatgaagtgaaaaagcctacgaaggtgaactaaaattttc taaca
Download
page-top