Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536982
Length 707 bp
Fasta Format > rwhei1d20
atattgggcaaattagaccanattttggaaatcaatgaccgttttacata cgcgcaggcattatatataaaccgaaagagagatagcatatggcgttgac acttttcgtcaacaacgtcacttgncggccattgctaccatgaagctcca ttacatcactgaaataanacccgaccgcctcnttgagccaccnagcggaa ttccaaaaggaacaggatgatagcggagttggtgcgcacaggaggtgatg atctcgtcaacaagcaccacagatccataaatgtaaggacgagaatcatg tcggcgcgcaaactttcgccgctctgcttggactcaagggtttataaatt aaccgtgcaacatcannaaacgagtgaatcctcctcgtcgcgcgggttct cgagggcggtgacgtgctccttgaaacgagccgcggcttcctccctctca tattccttgcccaggtggttatacgtcatcgccttgagatagtacacctc tgccgccatctcgtggtactctaaaacctgcaggtcttcagccgcttgat ttanagggtccagaacngcacaaggatcttcagaaactgaaaattctgga tcggttaagtgacattttgctaagactatctgagaccgagcacgcagctc aagaccgccatgggccgagaatcataggaaggcttngataaacaagactt aaggncc
Download
page-top