Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536979
Length 509 bp
Fasta Format > rwhei1d15
gagattttgcagtctagtagcactactgaataacactggtagcagtcaca gtcaaaccttacaccaaatgctcatcacgacatgagcatacacgacaacc acaggtccacataacgaaaaaataagtctgtcgaggcaaaacgaccaaca tttataacggaaaaaaaatagcatctagctatcatcacctaacagcacca cgagcactccaacgacttggcgagcgatataaggcatatccataggaaga atgggaggagatatggcttaggcggcctcctcgtcctcctgctcatcctc gtagtcctcttcctcctcgaccgtcgcgtcctggtactgctggtactcgg ccaccaggtcgttcatgttgctctcggcctcggngaactccatctcgtcc atgccctcgcccgtgtaccagtgcaagaaggccttcctcctgaacatggc ggtgaactgctcgttcccacggctgagggcgtgcccanctgacctatcnt aagagtang
Download
page-top