Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536975
Length 351 bp
Fasta Format > rwhei1d09
cagaagagcaggtaagtatgagtacaacatcattccctctggattatttt tatttttatttttacttccgatgaacaagcctgggcatcctttttcagcg tgccgacggcggtggagcgggcgggcagcagttgtcgccgcagcaggcgt ggccgcaggtcctcgtcggatgctccacgatccagcagcactggcacggc agtgaagcagtggtggttgtgatgaagagcgcaagcagaagcagcatgag ccaggacgccagggcaaggagagtgttcctcctcatgcctcctgttttgt ttgctgtgttcccctcttgatatgcttcacggttcagagctttcagggga g
Download
page-top