Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536971
Length 603 bp
Fasta Format > rwhei1d04
atatatttttttggttttttcgcctagcgcattaaactgaattacaacac aaggtccacatacacggcatccatactttacattcagtctttcagttttc agtgcggaagtaaacatgagtgctaataaccggacagaacgaagtaacat aagcatctagtagtgatgtattaaggacgtacgcaacctaccgttgtagt cagtcgctacaaaacagggcaccgttgacgaagccccgccgtcatcggct cttgtcatttggtcatttccgactgattctaccggtagtaagcctggtga aaggctggggccatggcattgccataggctcccgggccgctgttgtaacc ggcgtagatggggtaggtcatgggaggggcttggtatggcattccaaggc caacattaggcaccggcacagcaggtgggtatgcatatggctccctcatt gggctctggccacagtagagggcgtgcccagctgacctatcataagagta gggagatcaggtaccgtaggagacatgggaggctggagagccgatgaatg cggtggcagtgctgctgctggtggcggtcgcgggcgaagatggtgcaccg gtg
Download
page-top