Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536964
Length 706 bp
Fasta Format > rwhei1c18
ggtactggaaatgatcttgatgaacatatatattgttccatcagaatcac agctcaggggaaacagtagtggtctttcatcatcttcattaaccaggaca cgcgcaaaattcgataaaaactacgacaagtagacatatttaagcttgaa catagtaaggaggtccagtactgtaggtagcattgatatagggcggcagg ggcacgagcttagaacacccggaccggcttccccatggtgctcttgatgt acagacacctcacgttctgccagttcttcttgagcagggaaaccaggaag ttgacgctcatctggatgttctgctggatctgcttctcctccatcgacag gttgcccaccgcgacgcccatgcacagcaccttcttgagctggaacttga ttgtcgctttcgtctcgttcaccttggcttccagagactcctggtgagaa accagggtcgggaactttcctgccttgttgagaccaggaccaaggagacg tggaatctgcttgatgatagcctccgaggccaagaaagcatggtacttct tggcaagcctcttgacaagcttcttgttcttgttcatcttcttaagagct tcaacatccatggaatcaagaccaatcttttcagcctctcccacatgctg ggcgtcaccgagcatgcagaccctcatcttggggcgagggacgtgggggc agcttg
Download
page-top