Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536953
Length 760 bp
Fasta Format > rwhei1c06
acatgcatcattgcattgtttacggtacacacaagtctcgtgatgctaca gaccaaaagtacaacaaaacttccagcccaggtgatatgattggcaccca ggactgaaacaaatggcgtatagtgtattttctcactatatcaaagagaa taacttagtcgacctcctcgatcttggggccagcaccgccgctggcagcc ggcgcgtcctcgtccatgcctccgggcatgtcagcaccggcaccctggta catcttggcgatgatggggttgcagaggccctccagctccttcatcttgt cctcaaactcgtcaacctcaccaagctggttggcgtcaagccactggatc gcggcgtcgacagcatcctcaatcttcttcttgtcgtcagcaggcagctt ggaggcaatcttctcgtcctggatggtgttcctcatgttgtaggcgtagt tctccagggagttcttggcatcaaccttcttcttgtgctcctcatcctca gacttgtacttctctgcatcctggaccatcttctcaatgtcgtccttgct cagcctgcccttgtcgttggtgatagtgatcttgttcttctggccagtgg tcttgtcctcggcagagacattcaggataccgttggcatcaatgtcgaag cagacagtgatctggggaacacccctgggtgcaggcgggatgccggagag ctcaaacttgccaagcaggttgttgtccctggtccttgtcctctcaccct caaaaacctg
Download
page-top