Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536952
Length 718 bp
Fasta Format > rwhei1c03
acatccagggtttcaccgaagcttacattaggacagtatgtagaaggcac aagacagacaccactaagggcacgatatgcagcgctaacagctgaacagc tagaatatacccagtacgagcaatgcccttaacaaaactcagccaatact aaaaactgcttggtgcctgaaacagtgatttggatatcgattgtcaaatt acttcttcttgatggcagccttggtcaccttagccccggttgggtccttc ttctcgacgcccttgatgacaccaacagccacagtttgcctcatgtcacg tacagcaaaacgaccaagaggagggtaagtagcaaaggtctccacaacca tgggcttggtgggaatcatcttcactatgccagcatcaccattcttgagg aactttggcagggcctccagctccttaccagatcgcctgtcaatcttggt caccagctcagcaaacttgacagcaatgtgcgaggtgtggcagtccagca ctggggcgtagccgttgccaatctgaccagggtggttcatgatgatgacc tgggaggtgaagttggctgcctccttggcagggtcatccttggagttgga tgcaacaaacccacgcttcanatccttcacggcaacgttcttgacattga agccaacattgtcaccaggaancgcctccnggagagactcatggtgcatc tcaacggacttgacctca
Download
page-top