Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536946
Length 754 bp
Fasta Format > rwhei1b18
tctagaggcaaccacgaagttcgcaaatcaacaaacatcaggcaaaactt aaaaacgatggttccaggaacatagttctatatccttgcagataactggc tatagcaaaacgactcaacgcctcagaatcaggccttggcagcagcctgg gcagcggcatcccgcttcctctgctcctcaatgatggtgagcttgatacc cttgcccttggggaggctcacccatggcttggtgcccttgccaatggtga atacattgcccagacgggtggcgaactggtggccctgggcatcctcaacg tggatggtctcgaaggttcccttatgcttctccctgttcttgatcacacc aacacgcccagtgttgcgcccgccagtcaccatgaccacgttaccaacgt cgaacttgatgaagtcaacaatcttgttggtctccaggtcgagcttgata gtgtcattggccttgatgagagggtctgggtagcggatggtgcggccatc ataggtgttcaggtaggggatgcccttctggccgaactggacagacctga ccttgcagagcttgaacttagcatcctcatccctgacagagtgaaggcgg aagcggcccttggtgtcatacagaagcctgtagttctcaccagtcttggg aatggaaatgatgtccatgaaaccagcagggtaggtcttgtcagtgcgga cctttccatcaaccatgatatgacgctgcataangnatanactgcacttc acgg
Download
page-top