Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536944
Length 765 bp
Fasta Format > rwhei1b16
atcttcagcgtaaccttgccttgtccactttatcttagggacaagaacaa ttttaccacatctgcataactgggcacagacaatttggtaaaaactgctt gtttctaagtgcaatatgacaaacttcagaaagatgggagaaatgcctag tgtcattctaccatccatacagaaatgcctagccaaaactgtacgcaaac cagaaaagcctggtggatactactctactgaaaacgaaatatgcctagca agcagtttgtctctgttttggtcgttgaacattgaaagcttaaatgagct agtggtggtaatgacggccccgtcatagttcctagtaatgcccatgaaga cttcctttcagaataactggcagaaactcagtcatttgattatgactaag agctcgtgatcacctccacgcctggtttctttaagccggccatgtatgtt aggtagatggtccaaagaaacgcaaaggaattgcttactagcggctgtaa atgaacagggataaacttgaaagtgatgaagtcacaaagaggccaataaa tgagcccacttttgatggtcggaattatatcccgctttaatcttgcaatg atctctgggattgtctcaccttgtaatcctgcattatacgagaagaaaat acaattaataattgggccataaactgcttgtcctagaaacatcttcttga aggtgctcactacatcctttttggggactacttttgagataaagttgaac caatagtgcagtgaa
Download
page-top