Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536940
Length 760 bp
Fasta Format > rwhei1b10
ttgggaatccaaagaagccagcataaaaatacataccaacaaaaacatct ataccgacggtgcagccgaggttttcagcctgaaagactgaacactaaac cgacaaaaacatctataccgtccaagtaattccaccgtgctgaccaaaga aacctagatacgtgaaaaaataaagtgcaatcgaggtttcggtctgaacc aacacaacatttatttcatccaggttattgcacggtgttcaccagagaaa ccaagatacaagggaaatgacagtaaaatgctgaacccactgcggcgtct attccgtccaagtaatgcagggtgttggcacgatgtagtcgccgcttagg acagagaagaactcatgtcccagaatccaatttccagcttaagcacccga agaaaagcctcttcagcactcttgacaacatcaggtggcgcatttgccaa gcagcgatcagcgatccgctgcagagactggcagtactgcttgaactcag ggctgccccatctctgacacgtccccaggagctccgccggggtcttgtta ccttcttctatgcagaaagcaaaactatcctggtacacggtttcaattat ccaaaacgtagttatggctacagtgtagctgatctctggatcatcaaggc tttggagaaacctgcagtactccatattagaactgaggggagaaataccg gccagatcaacactccacttagcagcttccttcttgaaccaagagagctc atcactaaga
Download
page-top