Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536936
Length 762 bp
Fasta Format > rwhei1b03
aaagcaacgtatggcatcgtcggcaaccacaggtaaggttcatcttatca tagaggcaaattagatcttaagacgacaggctatgcatgcaaaaggcatg ggttgctgtagatggtccgtctagagaacatggacgatgagagtcaggcg gtgctctacggtaaccttgaaacaaaaggcgcagatacatccttcatgga tgtttgcacggtggcagaactctgaccagtttctggttattgtggctctc ttgtctgttcccagcatgatacgacaactggtgtgcagactgctgtttgc gagcttgaccttgagtgtgtcatcatctggtttgatgtactctttcagct tttctttggtgtagtggacctgaaaatactcacctatttctggcatcaaa gtcctctgccctcaccccctctccaagcagcaaggacacaaccaacatca gcaaaggaccttaaatcgaatagcttaattgagtatcttggccaaccctt tgtacctctcatatgtagttctgaggcaaagaacggagaataatcatttg aattgagtgcacaactgtagaccggcagccttcccggtgtcagtcttgat cacggacactggcctgatgtagccgcctccggccacccgccaacacccat gatggacgacgcgtacctgattccacaaggaagacgatcgagggctgtcg ctcacagcgccgctcttgtcttgacagccaccgccacatgtctanggaaa cttttctttccc
Download
page-top