Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536931
Length 693 bp
Fasta Format > rwhei1a22
caacagcacgggcggggacgaaggcttgcgccgccaatggcccacccaac accaaacctaggtccaagggtgtacaatcgcctcagcaggatcatgccag aggcagcaacagcaacacacattccgtttaggtatacacttgctacacag cgctccgtttcaagtgcacaagtgctgatttgttgcataaaactcatgct gtgggtaacagcgacacacagtcctgctttgtcgacggcatcgacgaggc agagaaaccgtcgcagctaacacattgacaacgtgtttctgctctcagct gtcgccgcttggttcatcgtcctcgtctaggttgatgccggagatactca tcttccccgtgtttacaactgcgtccagtccgcaaagatttggcatatac ttgctaatatgttcttcagcggctttatcagccttcagcgtctcgcattc gaaagagaccaagactttcttattcccatgtttcttttgaaccagtccaa caacgtcatcttcccatccatgcaaatggtcaatgttttgtaatcgagca gcatcatgtcccctgcattccaccacaaccaccttctctgtcttcctctt aaaattaatgatggatagctttataaggcggtaatcatctcctcggctac attccctctcgcatggtatcggggtgccctggaggccgtanca
Download
page-top