Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536929
Length 655 bp
Fasta Format > rwhei1a20
ggatgacgacaatgacaggcatacttcggtgctcagttaaacccccactg aacatacctatgcatctttcaacgccacaccaaaatccgctcacaccgaa ggacacatagctcaaaaggccaggaagcaactgcacacgtgcatgtggcg gccttgttctagtgcacaccgaaacgtttcgcgatgatctcgctcatgtc gatgaacctcttcgcgcagttgctcaggcagctggtctcgccggagctca gcttgctcccgggagcgcctgtgatgcacttgtcccagcactcgctcgtc accttgccgatcatctcgctcaccatcatcctctccttctcttgctcgat gaaccgctgcagctgggccgagtcgtccatggctgatggctcccgagggc gacggcgcgaggaccgctaaaaccctagttccggcggaggaggaggggga caagagagtgcatcgacgaatggctgagaagaaagaaactgtgccctgtt tgcaagtgtgggatcactagttaggcaatgcagttttagttttcgtgctt ttccttttagcacaacttactcagctgcatctttggatgcatttttctgt tggtagtggtacatatcgtatcggagggttgccatcggtgttctcccaat gcacc
Download
page-top