Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ536920
Length 742 bp
Fasta Format > rwhei1a03
atctccatcaaacttcctaaccccagatcgttaacaaaactatgtttctg gaatacattgatagcacaactaactgagacctcgaccaaaacattcggat cagaaagatatgaaaatggagacataaggcatggatcttcaggcggtttc agtcacagggtactcaaagacaacgtctttcccacaaagcctgcggtaga ctgcagagaaggtctccagcttgtattcagtgttgttgcgctcctttggg tccaagtagatcttgatgaccttggcaccatccaaacggtatctgacacg cttccccacaatctcagctgggtacacgacatcctccaagataccatcat gaacagctgtcagggtcctggtgcgagggcgctgaacagcagaacccttc ttgggtggcctcacaatccttcttgttgcaacaaagacaacatccttgcc gctaaacttcttctccagctccctgacgagcctgacatggatcttcctga agggcttgcgcagacggtacggcacatggatcaccacggccttcctgttg ccaacaacatccatctggattgcagtgttgatgtacaggtccttgaggtc gctcttgagctcctggttgccattctccaggtcaaagaaagcctgcgcaa cggtgtcctcgaactcggagggctcgacgcccttgtccttctggatcttc ttcctggcggtgtacatcttgcttccctttcnccgggccctg
Download
page-top