Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ645584
Length 454 bp
Fasta Format > whei20i22
gcagnggctggagaggccccgcgggcgctgtcccagaaggagcaggacat acagatgatgctcgccgccgacgtccacctcggcaccaagaactgcgact tccagatggagcgctacgcctacaagcgccgctccgacggcatctacatc atcaatctgggcaagacatgggagaagctccagctcgcggcgagggttat cgtcgccatcgagaacccccaggacatcatcgtccagtccgcccgcccct acggccaangcgccgtcctcaagttcgcgcagcacacaggcgccaacgcc atcgccgggaggcacacccctggaaccttcaccaaccagatgcagacctc cttcagcgagccccgcctgctcatcctcaccgacccaaggactgaccacc agnccatcaaggagtctgctctggggaacatccctaccattgccttctgt gaca
Download
page-top