Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ645583
Length 511 bp
Fasta Format > whei20i21
agtcnccgancaaccatggcggcagcggctggagaggccccgcgggcgct gtcccagaaggagcaggacatacagatgatgctcgccgccgacgtccacc tcggcaccaagaactgcgacttccagatggagcgctacgcctacaagcgc cgctccgacggcatctacatcatcaatctgggcaagacatgggagaagct ccagctcgcggcgagggttatcgtcgccatcgagaacccccaggacatca tcgtccagtccgcccgcccctacggccaacgcgccgtcctcaagttcgcg cagcacacaggcgccaacgccatcgccgggaggcacacccctggaacctt caccaaccagatgcagacctccttcagcgagccccgcctgctcatcctca ccgacccaaggactgaccaccagcccatcaaggagtctgctctggggaac atccctaccattgccttctgtgacactgactctcccatgcgatacgtcga tatcggcatcc
Download
page-top