Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ644486
Length 543 bp
Fasta Format > whei17h16
agagcggcggcgaagatggtgtcgctgaagctgcagaagcgcctggcctc gagcgtcctcaagtgcggcaagggcaaggtctggctcgaccccaatgagg tcaacgagatctccatggccaactcccggcagaacatccggaagctggta aaggatggtttcatcatcaggaagcctcagaagatccactccaggtctcg tgcaaggagggcacatgaggccaagcagaagggccgtcactctggatatg gtaagcgtaggggtaccagggaggctaggctccccaccaagatcctgtgg atgcggaggatgcgcgtcctgaggcgccttctgcgcaagtaccgtgaggc caagaagatcgacaagcacatgtaccatgacatgtacctgaaggtcaagg gtaacatgttcaagaacaagagggtcctcatggagagtatccacaagtcc aaggctganaaggcaagagagaanaccctctctgatcagtttgaggccaa ncgcgccaagancaagcaancangganaggaancatgccanga
Download
page-top