Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ644197
Length 575 bp
Fasta Format > whei16e16
acttgtcatttggggttattataagagtggaaactgaagcattccaggtt ctgaaaggagtgccagatagacctgaagtggtgcttgtaaaattaagaga aataaaaagcaagattgatcggcgtacatcagcgaaagataagtttaata atatggtcgcaaccaaggatgttgtcagagttgttgagggagcatgtaag ggaacacaaggacctgtggaacacatacataaggggatattgttcatata tgataggcaccaccttgaacatgcaggcttcatttgtgcaaaagcacaat cgtgcattcttgtcggtggatcgactggtggccgtcgtggaaatggtatg gatgctgcagatgctaggatgggtgctttgagatccccggcaagcatttt gcagtctccaggaaggctgcccccaagaggaccacaaatgaactatggtg gaagatttggaggaggtggtcgtggtggaanangacatgacnccttggtt ggcnnntgtatcnnaattanatctggtccttacnnnnggtaccgngnccn cnntnnnnagnnactgnnnngcttg
Download
page-top