Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ644069
Length 330 bp
Fasta Format > whei15m01
aagcccttcgtcgacatcctcaaggcgggcaatgtcctccctggcatcaa ggtggacaagggtaccattgagcttgctggaaccaacggtgagaccacca cccagggctttgatgaccttggcaagcgctgcgccaagtactatgaggct ggtgcccgcttcgccaagtggcgtgcagtcctcaagatcggcgccaccga gccatcgcagctctccatcgaccagaacgctcagggtctggctcgctatg ccatcatctgccaggagaatggtctggtgcccattgtggagcctganatc cttgttggatggacctcatgacattgaccg
Download
page-top