Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643798
Length 465 bp
Fasta Format > whei14m06
gattatgagaatggtgcaagcaaagggatagcttacatggattttactga tgagagttccttttcgaaagcacttgagcttagtggatctgacctaggtg gctgcaacttgtatgttgccgaagctaagcctaagggtcaatttggtggc gttggtggtcgatctggtggcagagatggtggccgctctggtggtggcag gtttggccggtctggtggccgtgatggcggcggcaggtttggccggtctg gtggccgtgatggtggcggcaggtttggccggtctggtggccgtgatggc ggcanaggangcggccgangctttcanagcanacanantgctggcacanc tancncagggaanaanaccacattnggtgacnattanaaactttttnanc cacaanatgnnctgatgcnactgccncnngnctanacnactgnatccccc nnntncccattannc
Download
page-top