Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643635
Length 496 bp
Fasta Format > whei14c04
tgtccgcttctgcgcggttggagacggccccgaggagcgcagcgcagctt ccataatgaaatggccgttcgtcaagatcgagatccgcccagatgctcct cacaggttccccggcctgagcctgtcaacgatccacggcatcatggatgc tgtgtaccagtcatcgggcaaagacggttgacttctgatgcccgcggtgt agatgtcttgaggcatcgatcgccaaaaggaggaggccagtgaggtgata gttcaatggaaccgcatagtggagataccatatatataggaggcatattg ccctccctgcctggaggatccggagacgcctgtgagataaataaagagcg ccccaccatatagtttgatccgttccggcatgtttgaatcgaattctgcc agtgttggcccatctttactgtcatcttgggaatcatctgctgttgtaag tcgtaactggttggttggttgttgtcgaaagtctgtaaaaaaaaaa
Download
page-top