Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643563
Length 641 bp
Fasta Format > whei13n03
cctcctcctcctcctcgtcgccgatgctccacaagaacctccgcgcgctc ggccccggcctcaatccgtttgcccccttcggcatgggcaactactcccg ctaatcccccctcccctcccctctcctctgctctgatttgcttttctccc cggatccgatttgcttctccccccttctcgttcttgatttgattggattg gattgctcctctctctgcttgattgcttggttggtttggatctgcttgca agattagccaaggggccatggtgcagctccgcagctcgctcagcatgacc cgggcgcgcgcccgcggcgactcggacgacgccgacgaccgcggctggaa ccagctccacgtcgccgcccgcaagggcaacctcaaggaggtgagacgtc tcctgaatgaagggatggatgtcaatgcacccgcatggggaccaaagtct cctggcgctactccgctgcaccttgctgctcagggcgggcatgtgaaaat catggatgaactactggagcgcggtgcaaatattgatgcccgaacaaaag gagcttgtggctggactcccctgcacattgctgccaaggaaagaaacaag agggtggtcangttccttgtcgagaacggcgcattcctgcc
Download
page-top