Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643467
Length 677 bp
Fasta Format > whei13h12
cgctttcagccacgcaacgatccactgcctcgctcccggccccgcgcctc cgccgtcctcgctcgccccgccgactccggccggatacgccggcccgctc ccggatcggacaggcttgcaagcatgtatattcgagtcaagcggaacaag accacctacttcatacagtgtgatccaacagagacaattttgaatatcaa gcagaagctgcagtcaataacagaccaccctcctaataaccagaggttga tcttgttggctaccaacaatatattggatgactccaagacgcttgctgat caaaaggtggagaatgacgccgtcgttgcattggcattgagaaaagacaa cgagttcgaggaggtgtccatcgccgacccaagcgattacatggcgtcct catgaggccggccggtccgtcgccgtccctcctacccaatccatgcaagg acactggtggcttccgtgaagcagatcatgttacttgcttgctctagcct ctagcctataggatgttgctcacttgtgtgattgtgtccttgctattaaa gaccctaaacaaccgttgcggatggcatttagtttggatttggaccctcc anccgatacgtgtgatgtgtgatctcaccacccaccggggcgtgtcctgg tgctccnacctacccncttttgtaccg
Download
page-top