Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643379
Length 553 bp
Fasta Format > whei13c06
tggggctcatccccgtctccggtctccgacgacgacgcggacgacgccgc cgttcgccgtcgccgccgagggctccgaccccgccgcctccgcggaggag ctgcagaagaagcgggaggaggacttcgacgccttcacgtccaccaagtc gcaggacctggcgcagccgctcgttgccgcgcagatcccctttaagatcc acgtcgtcaaggaccacgacatgaaggagcgcctctgcctcgaggccgag cgccttggcctgtcagccatgatcatgggaagccgcggattcggggcctc gcgcaagggcggcaaagggaggctcgggagtgttagtgattactgtgtgc atcactgtgtctgcccggttgtggttgttcgctacccagatgacgctgca ggtatccccggggaggcagcagcagcaacagatgagctgcacaccgtgcc ggaggatgagcccgtgtatcatgatgcgcctgacgnacacaaagaaaact gaggcaatggcatccaatcggagcgcaaggagaccatgaggcttgtgtac cta
Download
page-top