Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643211
Length 646 bp
Fasta Format > whei12f19
taacctccatccagaaagtaacacgaacaaaataagataactgaacgctg gctaggaatgtcgacagaagtactcaagaaatcagccatcaaaactgact acaaagttcacgacacccaggtggcacatatatcatcttctagatatgaa gcagcaaaatagcgacttctattttctactcagcagcagcaacctcctcc gctccaggaatcacctcatctccatcagcaggcctgtcaagcttcacacc aacatcctccttgtagtcaccgtgcacctccatgagcttccccaggtcaa acttgggggccttcaggatcttcaccttgcggacgtacacgttctggagg gggaagatgcttgaggtggccttctcaatctcctttccaatcacctcagg gatgaacttgttcacaagctccttcaagtcacagcttgcagcttggttga ccatgatctcaaccatcttgcggcggatctgtctgatctgacttgcttgg gcatagcaagtgcgcttcacctggtttgggcgtctcttcgtgaagccaat ggtgaacatgcggagcatgtagttgtcagtggtcttcncatccacatgag cctcaatgagtgtntgccacttcctcncaananacctgagcttgtc
Download
page-top