Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ643097
Length 462 bp
Fasta Format > whei11n11
cttttcgaaagcacttgagcttagtggatctgacctaggtggctgcaact tgtatgttgccgaagctaagcctaagggtcaatttggtggcgttggtggt cgatctggtggcagagatggtggccgctctggtggtggcaggtttggccg gtctggtggccgtgatggcggcggcaggtttggccggtctggtggccgtg atggtggcggcaggtttggccggtctggtggccgtgatggcggcagagga ggcggccgaggctttcanagcanacagagtgctggcacagctagcgcang gaanaanaccacatttggtgacgattanaaactttttgagccacaaaatg gtctgatgcaactgccgcgtgtctanacnactgtatccccntgtttccca ttatcctantggacctantatcatttntctntantattttcttgccncta tatnttntaatg
Download
page-top