Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ647648
Length 664 bp
Fasta Format > whei9l20
cgatctgacagctccgaaagtgactcagatgatagctcagatgaggatgt tcctgccaagactcctgctgctgctgccaagaaggtagattcttcagaca gttctgagtcggagagtgaatctgaggatgaggagaaatcaaagaaagcc gcacaggccaccaagatagctcctgcagctgctaaaagaaaggaggagcc cagtgattcctcagacagtgatgagagtgatgaagagcctccccagaaaa agctgaaggatgctgcgaaggttactcctaagtctgccaaaaaggacagc accagtgatgatgacagttctgatgaaagctctgatgatgagcctaaaaa gaaagttacaactgccacaaaatcacagaaggaagagcctaaaactcctg ctagcaacaaaggtcaggcaacagggtcgaagaccctttggatggggaac ctttccttcaatattgagtatgatcaagtgaagcaattttttgcacaaat tggagaggtcgttgatgttcgcctggctacccatgaagatggccatccca agggatttggtcatgttgagtttgctacngctgaanatgctcanaaagcg cttgattcactgaatggtggagatctantgggccgtccggtganacttga cntggctgctgaaa
Download
page-top