Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ647517
Length 373 bp
Fasta Format > whei9d21
gggttcagactgccacaaggcggccgtgatcggcgacaccatcggagacc ccctcaaggacacctcaggcccgtcgctcaacatcctcatcaagctgatg gccgtcgagtccctcgtgttcgcgcccttcttcgccacgtacggaggtgt gctgttcaagtacatctagaagactcgtcgagcggacttagaatctacgg acaccatcacgaataactctgccccgcccgcccgccgttcgtatgttgtg cgctgctgttatttttggttcttgtgtcattattccaggattgccgcagt ttacccccactttccctttggcctcttgggtgtgttacnttagtctcacc attaccggcttgtagctccatgt
Download
page-top