Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ292214
Length 505 bp
Fasta Format > whsl26m22
gcagagtttagctcgctcccagcccggccgctcaccatgtggaccaagaa ggtggcgacgcaggtggttttggtcctgcttctcctcctcatcgcacagg aggcggcggtgccgggggcggaggcgaagatctgccggcagcgcagcgcg gggttcaaggggccatgcgtgtcggacaagaactgcgcgcaggtctgcct gcaggaacgctggggcggcggcaactgcgacgggcccctccgccggtgca agtgcatcaggcagtgctgatcatatgtggaatgctacggctagctggcc ctcgccgtacgtcagctagctagcccatggagccatacgtctgtgtacct acttgaatgtgtgtgtgtgtgtgtgtgcccccttatacgtacgtatgtcg tatgtatatccgtgtcgccactagccagctgctgcatctcgatcgatgca tgcaagataataatatgaatgaataaaaacgtacggttcatgttcaaaaa aaaaa
Download
page-top