Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ646964
Length 569 bp
Fasta Format > whei7a23
gtccgtccgtcccggggagaagaccgccggcggaggagaggagacgcggg cgaggcaagaggagagtcaaatccccatcttgctcccccccccgcgccgc cgaccccacccgcggcattctctccggcgtccctcctccggccaggggga aaagcagcagcaggatggtgctgtgggtcttcgggtatgggtccctgatc tggaaccccggattcgacttcgacgagaagatcctgggattcatcaaggg atacaagcgaacgtttaatcttgcttgcattgaccatagaggcacaccac agcatccggccaggacctgcacccttgaatccgaagatgaagccatatgc tggggaattgcttattgtgtcaaaggtggtctagaaaaagagcgagaagc aatgcagtacttggagagaagagaatgcgagtatgaccanaagatctctg tggatttctacaaggatggaaattctctggaaccagctgtgacggatgta ttanttttcgtatccactcctgatccagttggcaacaaatactatcttgg ccctgctgctttggaggat
Download
page-top