Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ292210
Length 654 bp
Fasta Format > whsl26m18
ggggattttagcctccagcgccgccgccgccgcccagcgaattcgacaag cccccgagctcgccggatccgatggccgtcacgttctccgacctccacac cgccgacgggctcaaggccctcgaggcgcacctcgccggcaagacctaca tctccggcgatgggatcaccaaggacgacgtcaaggtgttcgcggcggtg cccgtgaagcccagcgccgagttcctgaacgctgcccgctggtacgacgc cgtcgccgcggccgtttcttcaaggttccctggccaggcctctggggtga gtgcatcctcggctcctgctgcagctgctcctgctgcttccaaggatgaa gatgatgacgatgacatggatctgttcggcgatgagaccgaggaggacaa gaaagcagcagctgagcgtgaggctgccaagcctgcaaagaagaaagaaa gtggcaaatcctccgtcctcatggacatcaagccatgggacgatgagact gacatgaagaagttggaggaggctgtccgcagtgttcaaatggagggtct cacctggggtgcatctaagcttatgcctgtgggttatggcatcaagaagc tccagatcatgctgacgatcatcgacgaccttgtgtctgtcgacaccctt attg
Download
page-top