Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ646715
Length 407 bp
Fasta Format > whei5p02
taccccgctctacaacatcaaggcctacctccccgtcattgaatcctttg ggttctcaagcaccctgagggccgcgacgtccggccaggccttcccccag tgtgtgtttgaccactgggacatcatggcttctgatcctttggacccagg cacccagtcggcgacgctcgtcacggatatccgcaagaggaagggcctca aggagcagatgacccctctatccgatttcgaggacaagctctaaattttt ggtgctgttatcccttacctggtcttgtgttgttaaagagagctgcacta ttttgtatcgatgagtcttgctgttatgacctacttgtcgtgatactggg aactatgttttgatgtctggtgatgtaacggatgttttacttanattaaa aaaaaaa
Download
page-top