Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ646115
Length 655 bp
Fasta Format > whei3i13
cccccggacgctcgagtccccgaccaaccatggcggcagcggctggagag gccccgcgggcgctgtcccagaaggagcaggacatacagatgatgctcgc cgccgacgtccacctcggcaccaagaactgcgacttccagatggagcgct acgcctacaagcgccgctccgacggcatctacatcatcaatctgggcaag acatgggagaagctccagctcgcggcgagggttatcgtcgccatcgagaa cccccaggacatcatcgtccagtccgcccgcccctacggccaacgcgccg tcctcaagttcgcgcagcacacaggcgccaacgccatcgccgggaggcac acccctggaaccttcaccaaccagatgcagacctccttcagcgagccccg cctgctcatcctcaccgacccaaggactgaccaccagcccatcaaggagt ctgctctggggaacatccctaccattgccttctgtgacactgactctccc atgcgatacgtcgatatcggcatcccagcaaacaacaaggggaggaacag cattggctgcctgtactggctcttggccaggatggttctgcagatgaggg gtactatcctgcctgggcacaagtgggatgtcatggttgatctgttcttc tacag
Download
page-top