Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ645922
Length 609 bp
Fasta Format > whei2m20
ctcagcccccagacgccgcagcgccgccactccacccgcagcggcaacca tggcggtcggcaagaacaagcgcatctccaaggggaggaagggtagcaaa aagaaggccgtcgatccgttcaccaagaagcagtggtatgacatcaaggc gccgctgctgttcaccagccgcaacgtcggcaagaccctcgtgtccagga cacagggtaccaagattgcctcagagggtctgaagcacagggtgttcgaa gtatctctagctgatcttcagaacgatgaggaccaggcctacaggaagat cagactccgtgctgaggatgtgcaagggatgaatgtcctcacaaacttct ggggcatggacttcaccactgacaagctcaggtctcttgtgaggaagtgg cagacactcattgaggctcatgtggatgtgaagaccactgacaactacat gctccgcatgttcaccattggcttcacgaanagacgcccaaaccangtga ancgcacttgctatgcccaancaagtcanatcanacanatccnccncaag atggttgagatcatggtcaaccaagctgcnanctgtgacttgaagganct tgtgaacaa
Download
page-top