Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ645358
Length 529 bp
Fasta Format > whei1l09
cgcactctgccgccgcagccgcagccgcagccatgggcgcgtacaagttc gtgtcggagctatggaggaggaagcagtcggacgtgatgaggttcgtgca gcgcgtgcgttgctgggagtacaggcagcagccggccatcgtgcgcatca ccaggcccacccgccccgacagggctcgccgtctcggcttcaaggccaag caggggtatgtggtctaccgtatccgtgtcaggcgtggtggcaggaagag gccagtgcccaagggtattgtctatggtaagcccaagcaccagggtatta cccagctcaagttccagaggaacaagaggtctgttgctgaagaaagagct gggcgcaggctgggtggtcttcgtgtgctcaactcctactgggtgaatga ngactctacctacaantactttgaggtcatccttgttgatgttgctcaca ntgctgtccncaacnacccaangatcaactggctctgcaancccntncac aancaccntnancttcncnnactcanntc
Download
page-top