Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ532034
Length 663 bp
Fasta Format > rwhec1l21
acaaactcccgtgtctgctcaaagggagtgaacgaacaatcaaacgctga tacaaaatagatacaacagtggccagctatgcaaagctggctcgatgtac gtactcctatctctcacatggagatcatatcagagcatttattcatgtat atgtatatatgtgtgtgtgagacctcaacgtactcagcatcaatcgctgg aactataatcggcgatgatggcggccagaaatcgatcagtggatcttaga gcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttgg agggaatgcctgcggccttgttggggttgagccctccggcaacactcttg aggcacctgcatgtagcttgcttgtcggcggtgctccgcgctaagccggc caatttcctgacgccgctgcagcaggccccagacgggctggtcccgctgc ccttcgcataggcgacgcagggggtcaaggcagagctcacctggccgcag ctgatggccgcgtcggaggctgcgaggatcattgccgccaccagggcgac cagcacgagcttantagctgcagtgcgagccatctcgaccgagttagctg tanttgtggaccttgtggtggtgggctanctcacngananagggtgggat anctanatttgct
Download
page-top