Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ532033
Length 414 bp
Fasta Format > rwhec1l20
ctcggtactttangcgatagcgttantcttaaggggaaattagctaatgc catacagaccatnagggtatctctccnattcatnatgaancaccacaggt agtnangtacaactatactaggttctctnaacacngncctaaaggacaat aggtgtgaggtttcgtgaagtgaaaacggtgaaaatgctactcccaagac tccnntgcatgtcgtcctcaggatttacctcnacnncggggcacaacttg tgggttaaaggatcctgaaccacaagtaccaanactgctagngacacgac gcccnncagccacccctgctcggcaacnaccacggagaggagatgcgtcg ggganagcagcaacctcgcggctcacggcggcggnaancaccaccancan cancnacggcagca
Download
page-top