Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ531244
Length 615 bp
Fasta Format > rwhec17l23
agacgaggcgtcaatagctcaatccatttgcacagtagtacggttacatg agctaattcagtttttgtaccagtcaagaaacagaacagagaaagtaaga acaaagaagaaaagcaggagaaaggttctactgctgctgttccgctggat cgcctgggatagctccttgttcccacgctccacgttgtttgttgcttcca ccgcctggtcgtacaaatattgaatctgctgagcttgctgtagaacatgt gttgacataagatgattaagtgctgacatctctatcatctttgtctccgt ttcttggacagtatcaagaagattggtcaactccatctggagagctcgtg tttcatcgtccaagagttgttcttgaactcttaagggcgcagttgatacc tcccggtcttcaaccttcgagacatcagatttcaatacaaggtttgactt ggatggttcagtaggttttatatctggcttcttcttgatcttctttcttg gcatcaccctattaatagcttcttgaaagcgcagggacctaaggcgatca aattgtgcagttactgagtggagacgctcgcttaaaatcaaaaccacacc atgctggtgagctat
Download
page-top