Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530891
Length 446 bp
Fasta Format > rwhec16h21
aatcagaaccaaaattactaacagatatccntcgctcgatagccaaaata cagagattgttaagtcttcactccactacagaacccctggattcctcaag acaacagtagggcaatcntgcttcggtctgctccctcaagcgacggatcg tgctcctgacggtgactgcactancagtgttcatggnataggcgccgcca gccttgaccttgccacagtccttgcatccccnaattccaacagctttcct cttcncagcanacttcccacagaattcacagaagtacttggagtgctgag acacctccatcttcttgatctgcttacgcaaactggcaccatacctggta ccatacttcccgacgattccngccttcttggtgcgcttcgtcatctcggc ggcgggtagcnggaggcggctgcggcggcgtaggcggggagatggc
Download
page-top