Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530855
Length 505 bp
Fasta Format > rwhec16f24
tctggcattcacatatagcggcaagaaaatactacagacaaatgatacta ggtccactaggataatgggaaacacggggatacagtcgtctagacacgcg gcagttgcatcagaccattttgtggctcaaaaagtttctaatcgtcacca aatgtggtcttcttccctgcgctagctgtgccagcactctgtctgctctg aaagcctcggccgcctcctctgccgccatcacggccaccagaccggccaa acctgccgccaccatcacggccaccagaccggccaaacctgccgccgcca tcacggccaccagaccggccaaacctgccaccaccagagcggccaccatc tctgccaccagatcgaccaccaacgccaccaaattgacccttaggcttag cttcggcaacatacaagttgcagccacctaggtcagatccactaagctca agtgctttcgaaaaggaactctcatcagtaaaatccatgtaagctatccc tttgc
Download
page-top