Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530843
Length 658 bp
Fasta Format > rwhec16f08
taacagctcancgggtttctcccttcccttccctcgggatcaggctaggt aggtacnacaacataataagatatagcagatagcctaacacagcagcata acgataataatctcaatagggcagacagatcaaaataatagcaactggag ccagccagccagccaacaccttcctctcctcttcacttggcctcgtgctt tgccttggagtgcgaagctagagcgccctcgctgttgaatgtcttgctgc acgacttgcacgcgaccgaccctccagacttgggcgacttgtcgctggta nccggggtcttgcctgccttcttggccgggtgaggagtcgccacatggac agctcccttcttgtcgcctgtcttctggcctgacggtgttgcaatcttgg ccttcttgtcagtaacaggggtcttcaacacgcttccagccgccctcttc ttcccantctcttgnttcttgggtgtttcttcttcctcctcatcagagct atcctcactatcatcagaggaatcatcaccgccctcactatcatcagaat catcctccatggagatgatggancattgattcccanagtcntcttggctg tcatcctcatcactgtcatcatcatcatcgctgtcatcatccttgttaga ttntcccc
Download
page-top