Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530842
Length 707 bp
Fasta Format > rwhec16f07
aacgcatcaacactaacagctcaacggtttctcccttcccttccctcggg atcaggctaggtaggtacgacaacataataagatatagcagatagcctaa cacagcagcataacgataataatctcaatagggcagacagatcaaaataa tagcaactggagccagccagccagccaacaccttcctctcctcttcactt ggcctcgtgctttgccttggagtgcgaagctagagcgccctcgctgttga atgtcttgctgcacgacttgcacgcgaccgaccctccagacttgggcgac ttgtcgctggtagccggggtcttgcctgccttcttggccgggtgaggagt cgccacatggacagctcccttcttgtcgcctgtcttctggcctgacggtg ttgcaatcttggccttcttgtcagtaacaggggtcttcaacacgcttcca gccgccctcttcttcccagtctcttgcttcttgggtgtttcttcttcctc ctcatcagagctatcctcactatcatcagaggaatcatcaccgccctcac tatcatcagaatcatcctccatggtgatgatggagcattgattcccagag tcatcttggctgtcatcctcatcactgtcatcatcatcatcgctgtcatc atccttgttanattttcccccatccttancacaggcttggactttgaagg ggcanca
Download
page-top