Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530832
Length 663 bp
Fasta Format > rwhec16e13
atatttaaagctcagacaataaccattgtaccagaatagcatgcgatcta cttcaacgaagtcttggataacaaacacaggggggtatcataattcaaaa ctgtagccaaattctactaccgaacacgattgcatagaggggacttcaac tgatcagaattcggcaggaacagttcctgcaacctggtccagatcacgcc ttccctgggaggtgatgagccttccacccttggggtccacatcaatgatg cccatcttctgcaactcctggaggatgttgcgggacacagcaccactgct cttgcagaagtgcggtgggcgtgaaccattcctctgacggccaccgtaga tcttctggaagccgccgatcccaattccctgcctcaggtagatcttcctt gccatcgaggcagccctgatgtagtaccagtcagcatcagaaggtggaag ctccttgaaccttgcagtcttgacaatgtcaacccactccggaagctcca tcttgccggagcgcttgaggtgcgcggagtaggccttgacgaactcgtgg gggttgacatccttcaccgtgcgcgccgtggaggccgcggtctcggctgc gggagcgggcacggtcgccatcctgtgctctcgccgacggcggcgctgtc ttcnnggangang
Download
page-top