Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ291900
Length 547 bp
Fasta Format > whsl25f08
ttcggcacgagggcccgactttgaccgcctcctcgtctccgctcccacgc ccgcgggnagagaggcgaccggcggcggcgcgcgaggaggggcctaccca cccatcccaccaccccgccggcgaagatgttcggccgcgcccccaagaag agcgacaacaccaagtactacgaggtgctcggggtgcccaagaacgccgc ccaggacgacctcaagaaggcctaccgcaaggccgccatcaagaaccacc ccgacaagggcggagaccccgagaagttcaaggagctggcacaagcctat gaggttttgagtgaccctgagaagcgtgagatctatgatcagtatggcga agatgctctcaaggaaggaatgggtggaggaggaggtggtgggagttgat ccatttgacatcttctcatcatttttcgggccctcttttggaggtggtgg tggcggcagcagcaggggcagaaggcaaaggaggggagaggatgttgtcc atccacttaaagcttctctagaagatctttacaatggtacctcgaag
Download
page-top