Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ530732
Length 669 bp
Fasta Format > rwhec15o05
cattcggacatatatactctaagcaacaaagaacagatatcacaaatggg ggaaaggggagaaaaaaaatcacaatgtacgctgctgcaggtttcgtaga cagtggttctcagcagcatgggcggctaaccaaaggggcaacaattaatt tagataaactcctcccgtcttcatctacaaccaaaaaaatcccatctaac cccctccggtatttacacgaggggggcagatactcttgagcgccgatgat ccgatcagcagttgacgccgcactgccccatggcgacggccttctgggtg tcggatatgaacgggtcgatcttcacccacaggagggagaagatggaggc gaggaggatggaccagacgatgacgatggtcggcgtgcggttctgctttc ccatgagacccttgaggaaggggtagagatggaggatcacccagatcgag aagaagagctttccgaagagcgggccccaggattggtagccgctgttgat ggcgtatgatatgccggccaccatgcccacaaggttgatgaccaggacgg tggtcggagggatcangagactggtccacttgaacacgtatagctcggcg aagtcgccgtcctcntcgttcgccttggatgtgacagtgaattggtgtcn atcccggccancaccttga
Download
page-top